Penanganan Terkini Infeksi Kaki Tangan dan Mulut (HFMD) atau Coxsackie A16

Penanganan Terkini Hand, Foot, and Mouth Disease (HFMD) atau Coxsackie A16

Flu Singapura atau Infeksi Mulut Kaki Tangan

Widodo Judarwanto, Children Grow Up Clinic Jakarta Indonesia

Audi, berumur 2 tahun tiba-tiba tidak mau minum susu dari botol dan tidak mau makan. Bahkan anak saya sampai nangis menjerit-jerit kalau mau ditidurkan dan diberi susu botol. Ternyata di mulutnya timbul banyak sariawan. Beberapa hari kemudian, di kedua telapak kaki dan tangannya muncul bintil-bintil berisi air. Bisul itu semula kecil tetapi lama kelamaan bertambah besar. Bentuknya mirip seperti cacar air. Karena selama 3 hari tidak mau makan dan minum sama sekali akhirnya dirawat di rumah sakit dan didiagnosis terkena “flu Singapura

“Flu Singapura” sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM ).  Sebenarnya istilah Flu Singapura adalah kurang tepat karena dalam literatur dan dalam istyilah dunia kedokteran tidak dikenal istilah demikian. Mengapa disebut flu singapura sampai sekarang juga belum diketahui asal usulnya. Mungkin saja karena pertengahan September tahun 2000 lalu, penyakit tangan, kaki dan mulut pernah merebak di Singapura. Pemerintah Singapura bahkan sampai menganjurkan agar seluruh restoran siap saji, kolam renang, dan tempat bermain anak-anak ditutup sementara setelah tiga anak diberitakan meninggal karena diduga terkena penyakit tersebut. Sebanyak 440 taman kanak-kanak (TK) dan 557 pusat perawatan anak diliburkan.

Infeksi Kaki, Tangan dan Mulut ( KTM ) adalah penyakit virus akut yang muncul sebagai erupsi vesikular di mulut. Infeksi ini juga dapat melibatkan tangan, kaki, pantat, dan  atau alat kelamin. Coxsackievirus Tipe 16 (CV A16) adalah virus penyebab yang terlibat dalam sebagian besar kasus infeksi KTM, tetapi penyakit ini juga terkait dengan coxsackievirus A5, A7, A9 A10, B2, dan strain B5. Enterovirus 71 (EV-71) juga menyebabkan wabah HFMD dengan keterlibatan neurologis terkait di wilayah Pasifik barat.
Coxsackievirus adalah subkelompok dari enterovirus dan merupakan anggota dari keluarga Picornaviridae. Keluarga ini terdiri dari kecil, tidak memiliki amplop, beruntai tunggal virus RNA.

Infeksi KTM adalah penyakit berjangkit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (bahasa Spanyol Pico:kecil), Genus Enterovirus (non Polio). Dalam dunia kedokteran, Di dalam Genus Enterovirus terdiri dari virus Coxsackie A, virus Coxsackie B, Echovirus dan Enterovirus. Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

Penyakit KTM sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum yang menyerang anak-anak usia 2 minggu sampai 5 tahun (kadang sampai 10 tahun). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, air liur, tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang-barang yang terkontaminasi oleh sekresi itu. Tak ada vaktor tapi ada pembawa seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain enterovirus lainnya.

Wabah KTM cenderung terjadi setiap 3 tahun di Amerika Serikat. Kejadian HFMD di seluruh dunia dilaporkan.  Pola musiman terjadi di daerah beriklim sedang, dengan kejadian puncak pada akhir musim panas dan awal musim gugur.  Infeksi KTM lebih berat pada bayi dan anak dibandingkan orang dewasa, tetapi umumnya, penyakit ini memiliki manifestasi ringan.

Tidak ada predileksi ras untuk penyakit infeksi ini. Rasio penderita laki-laki dan perempuan adalah 1:1. Sebagian besar kasus tangan-kaki-dan-mulut penyakit mempengaruhi anak-anak muda dari 10 tahun, meskipun kasus pada orang dewasa dilaporkan.

Penyebab dan Penularan

Penyebab yang paling sering terjadi adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

Penyakit ini sangat menular dan sering terjadi dalam musim panas. Penyakit ini merupakan penyakit umum atau biasa terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya kebal terhadap enterovirus, kecuali bila daya tahan tubuhnya menurun. Masa inkubasinya sekitar 2-5 hari. Sementara untuk waktu terekspos sampai terkena penyakit 3-7 hari.

Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa seperti nyamuk atau lalat . Penyakit ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya.

Beberapa penyakit yang juga disebabkan karena virus sejenis ini adalah penyakit ini  adalah Vesicular stomatitis dengan exanthem (KTM) – Cox A 16, EV 71 (infeksi KTM) dan Vesicular Pharyngitis (Herpangina) – EV 703. Acute Lymphonodular Pharyngitis – Cox A 10

MANIFESTASI KLINIS :

Gejala awal adalah demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, ruam di bagian mulut, tangan dan kaki, dan mungkin di bagian popok. Gejala seperti flu pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus di mulut seperti sariawan terasa nyeri sehingga sukar untuk menelan. Timbul rash/ruam atau vesikel (lepuh memerah/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Jenis virus tertentu gejalanya dapat lebih parah yaitu demam tinggi lebih dari 38% selama 2 hari. Ada gejala flu, sesak napas, kejang-kejang, ulkus, seriawan pada rongga mulut, lidah, dan kerongkongan. Jika timbul gejala seperti ini harap sesegera mungkin dibawa ke rumah sakit terdekat untuk mendapatkan perawatan intensif karena dapat menyebabkan kematian. Tempo pengasingan yang disarankan adalah hingga lepuh kering.

Manifestasi Klinis Infeksi KTM yang harus diwaspadai

  • Hiperpireksia ( suhu lebih dari 39 der. C).
  • Demam tidak turun-turun (Prolonged Fever)
  • Tachicardia (denyut jantung cepat)
  • Tachypneu (sesak)
  • Tidak mau makan, muntah atau diare sehingga kekurangan cairan dehidrasi.
  • Lethargi atau lemah dan kesadaran menurun
  • Nyeri pada leher,lengan dan kaki.
  • kejang.

Komplikasi

Meski sangat jarang, dalam keadaan daya tahan tubuh yang sangat rendah atau immunocomprimized dapat terjadi komplikasi yang berbahaya dan mengancam jiwa. Komplikasi yang dapat terjadi adalah Meningitis atau infeksi otak (aseptic meningitis, meningitis serosa/non bakterial) atau Encephalitis ( infeksi otak bulbar ). Komplikasi yang sangat jarang lainnya adalah Myocarditis atau gangguan jantung (Coxsackie Virus Carditis) dan gangguan persarafan  pericarditiso Paralisis akut flaksid

Infeksi enterovirus juga dapat menyebabkan miokarditis, pneumonia, meningoensefalitis, dan bahkan kematian. Infeksi ini jarang terjadi  berulang dalam waktu dekat. Meski secara umum infeksi ini ringan namun, sebuah wabah besar infeksi KTM  disebabkan oleh Enterovirus 71 di Taiwan dilaporkan terjadi angka kematian tinggi sekitar 19,3% pada kasus berat. kematian disebabka karena akibat perdarahan paru. Selama wabah ini, angka kematian yang tertinggi pada anak-anak muda dari 3 tahun. Sedangkan kasus infeksi KTM di singapura pernah dilaporkan telah merenggut 7 korban jiwa, sebagian besar dari pneumonitis interstisial atau ensefalitis batang otak.  Infeksi KTM adalah penyakit ringan namun dalam keadaan temuan fisik yang tidak biasa, peningkatan jumlah sel darah putih, dan muntah dan tidak adanya ulkus oral atau luka sariawan di mulut mungkin menandakan pasien dengan risiko tinggi hasil yang dapat berakibat fatal.  Dalam salah satu penelitian terhadap wabah infeksi KTM yang disebabkan oleh Enterovirus 71 di Sarawak, Malaysia dilaporkan terdapat 3 faktor risiko klinis untuk membantu mendeteksi anak-anak berisiko untuk komplikasi neurologis.  Total durasi demam selama 3 hari atau lebih, ketinggian puncak suhu lebih besar atau sama dengan 38,5 ° C, dan riwayat kelemahan tubuh secara umum terkait dengan pleositosis cairan serebrospinal.

Infeksi KTM bila terkena pada ibu hamil pada trimester pertama dapat mengakibatkan aborsi spontan atau hambatan pertumbuhan dalam kandungan.

Pemeriksaan laboratorium

Bahan pemeriksaan yang dapat diambil dari tubuh dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak. Spesimen dibawa dengan Hanks Virus Transport. Isolasi virus dencara biakan sel dengan suckling mouse inoculation. Setelah dilakukan “Tissue Culture”, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Pemeriksaan laboratorium yang diperlukan untuk penelitian klinis. Deteksi Virus   Immuno histochemistry (in situ) dengan Imunofluoresensi antibodi (indirek) Isolasi dan identifikasi virus. Pada sel Vero RD, L BUji netralisasi terhadap intersekting pool. sAntisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum. Deteksi RNA :RT-PCRPrimer : 5 CTACTTTGGGTGTCCGTGTT 35 GGGAACTTCGATTACCATCC/ Partial DNA sekuensing (PCR Product). Serodiagnosis Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero. Uji ELISA sedang dikembangkan. Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

Penanganan

Tidak ada penanganan khusus dalam infeksi penyakit ini. Disarankan istirahat yang cukup. Sedangkan pengobatan spesifik tidak ada. Pengobatan simptomatik atau mengobati gejalanya. Pada hampir semua kasus tidak perlu pemberian antibiotik. Pemberian obat jamur untuk oles mulut tidak ada relevansinya secara langsung dengan penyeakit ini karena penyebab infeksinya adalah virus.  Kadangkala dibutuhkan antiseptik atau obat kumur penghilang rasa sakit didaerah mulut. Pemberian obat demam atau penghilang rasa sakit analgesik misal parasetamol. Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam.

Perawatan utama adalah terapi suportif. Bahkan, tidak ada agen antivirus khusus untuk agen etiologi. Pastikan asupan cairan yang cukup untuk mencegah dehidrasi. Cairan dingin umumnya lebih baik. Zat pedas atau asam dapat menyebabkan ketidaknyamanan. Hidrasi intravena mungkin diperlukan jika pasien memiliki moderat sampai berat dehidrasi atau jika ketidaknyamanan menghalangi asupan oral.  Masalah yang paling mengganggu adalah kesulitan makan dan minum yang dialami penderita. Hal ini terjadi karena terjadi banyak luka kecil seperti sariwan di sekitar mulut yang sangat sakit dan pedih saat makan. Dalam keadaan tertentu kadangkala pemberian makan dan minum yang dingin dapat mengurangi rasa sakit saat makan. Makan dan minum dingin tersebut seperti es teh manis, bubur sumsum dingin atau susu yang dingin.

Penyakit ini adalah dapat sembuh sendiri atau self limiting diseases. Biasanya akan membaik dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Demam dapat diobati dengan antipiretik. Nyeri dapat diobati dengan dosis standar asetaminofen atau ibuprofen. Analgesia langsung juga dapat diterapkan untuk rongga mulut melalui obat kumur atau semprotan. Imunoglobulin intravena (IVIG) dan milrinone telah menunjukkan keberhasilan di beberapa beberapa laporan.  Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas. Pada penderita dengan kekebalan tubuh yang rendah atau neonatus dapat diberikan : Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

PENCEGAHAN

Penyakit ini diduga sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Tetapi tampaknya pada masyarakat menenggah ke atas dengan sanitasi yang baikpun masih sering terjadi. Sering terjadi penularan di tempat yang padat seperti sekolah. Kebersihan Higiene dan Sanitasi dengan memperhatikan kesehatan lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.

Infeksi KTM tersebar dari orang ke orang melalui hidung dan cairan tenggorokan seperti air liur, dahak, atau ingus, cairan yang melepuh, atau tinja dari orang yang terinfeksi. Cuci tangan dengan baik dan sering dengan sabun dan air. Disinfeksi permukaan yang kotor dan barang-barang kotor.

Cuci tangan dengan seksama Pastikan untuk mencuci tangan sering dan menyeluruh, terutama setelah menggunakan toilet atau mengganti popok. Dan sebelum menyiapkan makanan dan makan. Bila sabun dan air tidak tersedia, gunakan lap tangan atau gel diobati dengan membunuh kuman alkohol. Kalu perlu dalam keadaan seperti ini bila bersekolah dan bepergian ke tempat umum menyediakan tisu basah atau hand wash anti septik.

Disinfeksi Area publik. Bersihkan dengan cermat daerah area publik  dengan sabun dan air, lalu dengan larutan diencerkan pemutih klorin, sekitar 1/4 gelas (59 ml) dari pemutih untuk 1 galon (3,79 liter) air. Pusat perawatan anak harus mengikuti jadwal ketat pembersihan dan desinfeksi semua area umum, termasuk item bersama seperti mainan, karena virus dapat hidup di benda-benda ini selama berhari-hari. Bersihkan dot bayi Anda sering.

Ajarkan kebersihan yang baik. Tunjukkan anak Anda bagaimana untuk menerapkan kesehatan yang baik dan bagaimana menjaga diri mereka bersih.  Jelaskan kepada mereka  untuk tidak menempatkan jari, tangan atau benda lain di mulut mereka.

Mengisolasi orang menular. Karena infeksi ini sangat menular secara cepat maka harus dibatasi kontak terhadap orang lain. Hindari kontak erat seperti mencium, memeluk, atau berbagi peralatan makan atau gelas dengan orang yang terinfeksi. Hindari penderita infeksi KTM dari  penitipan anak atau sekolah sampai gejala demam hilang dan mulut luka telah sembuh.  Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan. Di Rumah sakit “Universal Precaution” harus dilaksanakan. Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

Daftar pustaka

    • Chang LY, Lin TY, Huang YC, Tsao KC, Shih SR, Kuo ML, et al. Comparison of enterovirus 71 and coxsackie-virus A16 clinical illnesses during the Taiwan enterovirus epidemic, 1998. Pediatr Infect Dis J. Dec 1999;18(12):1092-6.
    • Chong CY, Chan KP, Shah VA, Ng WY, Lau G, Teo TE, et al. Hand, foot and mouth disease in Singapore: a comparison of fatal and non-fatal cases. Acta Paediatr. Oct 2003;92(10):1163-9.
    • Chan KP, Goh KT, Chong CY, Teo ES, Lau G, Ling AE. Epidemic hand, foot and mouth disease caused by human enterovirus 71, Singapore. Emerg Infect Dis. Jan 2003;9(1):78-85.
    • Chen SC, Chang HL, Yan TR, Cheng YT, Chen KT. An eight-year study of epidemiologic features of enterovirus 71 infection in Taiwan. Am J Trop Med Hyg. Jul 2007;77(1):188-91.
    • Chen KT, Chang HL, Wang ST, Cheng YT, Yang JY. Epidemiologic features of hand-foot-mouth disease and herpangina caused by enterovirus 71 in Taiwan, 1998-2005. Pediatrics. Aug 2007;120(2):e244-52.
    • Ahmad K. Hand, foot, and mouth disease outbreak reported in Singapore. Lancet. Oct 14 2000;356(9238):1338.
    • Chen TC, Chen GW, Hsiung CA, Yang JY, Shih SR, Lai YK, et al. Combining multiplex reverse transcription-PCR and a diagnostic microarray to detect and differentiate enterovirus 71 and coxsackievirus A16. J Clin Microbiol. Jun 2006;44(6):2212-9.
    • Thomas I, Janniger CK. Hand, foot, and mouth disease. Cutis. Nov 1993;52(5):265-6.
    • Toida M, Watanabe F, Goto K, Shibata T. Usefulness of low-level laser for control of painful stomatitis in patients with hand-foot-and-mouth disease. J Clin Laser Med Surg. Dec 2003;21(6):363-7.
    • Wang SM, Liu CC. Enterovirus 71: epidemiology, pathogenesis and management. Expert Rev Anti Infect Ther. Aug 2009;7(6):735-42.
    • Chan YF, AbuBaker S. Recombinant human enterovirus 71 in hand, foot and mouth disease patients. Emerg Infect Dis. Aug 2004;10(8):1468-70.
    • Chang LY, King CC, Hsu KH, Ning HC, Tsao KC, Li CC, et al. Risk factors of enterovirus 71 infection and associated hand, foot, and mouth disease/herpangina in children during an epidemic in Taiwan. Pediatrics. Jun 2002;109(6):e88.
    • Cherry JD. Contemporary infectious exanthems. Clin Infect Dis. Feb 1993;16(2):199-205.
    • Faulkner CF, Godbolt AM, DeAmbrosis B, Triscott J. Hand, foot and mouth disease in an immunocompromised adult treated with aciclovir. Australas J Dermatol. Aug 2003;44(3):203-6.
    • Frydenberg A, Starr M. Hand, foot and mouth disease. Aust Fam Physician. Aug 2003;32(8):594-5.
    • Hooi PS, Chua BH, Lee CS, Lam SK, Chua KB. Hand, foot and mouth disease: University Malaya Medical Centre experience. Med J Malaysia. Mar 2002;57(1):88-91.
    • Kuo RL, Kung SH, Hsu YY, Liu WT. Infection with enterovirus 71 or expression of its 2A protease induces apoptotic cell death. J Gen Virol. Jun 2002;83(Pt 6):1367-76.
    • McMinn P, Stratov I, Nagarajan L, Davis S. Neurological manifestations of enterovirus 71 infection in children during an outbreak of hand, foot, and mouth disease in Western Australia. Clin Infect Dis. Jan 15 2001;32(2):236-42.
    • McMinn PC. An overview of the evolution of enterovirus 71 and its clinical and public health significance. FEMS Microbiol Rev. Mar 2002;26(1):91-107.
    • Miller GD, Tindall JP. Hand-foot-and-mouth disease. JAMA. Mar 4 1968;203(10):827-30.
    • Modlin JF. Enterovirus deja vu. N Engl J Med. Mar 22 2007;356(12):1204-5.
    • Modlin JF. Coxsachie Virus, Echoviruses, and Newer Enteroviruses. In: Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Disease. 5th ed. 2000:1904-17.
    • Ooi MH, Solomon T, Podin Y, Mohan A, Akin W, Yusuf MA, et al. Evaluation of different clinical sample types in diagnosis of human enterovirus 71-associated hand-foot-and-mouth disease. J Clin Microbiol. Jun 2007;45(6):1858-66.
    • Ooi MH, Wong SC, Clear D, Perera D, Krishnan S, Preston T, et al. Adenovirus type 21-associated acute flaccid paralysis during an outbreak of hand-foot-and-mouth disease in Sarawak, Malaysia. Clin Infect Dis. Mar 1 2003;36(5):550-9.
    • Prager P, Nolan M, Andrews IP, Williams GD. Neurogenic pulmonary edema in enterovirus 71 encephalitis is not uniformly fatal but causes severe morbidity in survivors. Pediatr Crit Care Med. Jul 2003;4(3):377-81.
    • Scott LA, Stone MS. Viral exanthems. Dermatol Online J. Aug 2003;9(3):4.
    • Shekhar K, Lye MS, Norlijah O, Ong F, Looi LM, Khuzaiah R, et al. Deaths in children during an outbreak of hand, foot and mouth disease in Peninsular Malaysia–clinical and pathological characteristics. Med J Malaysia. Aug 2005;60(3):297-304.
    • Shimizu H, Okuyama K, Hirai Y. Epidemic of hand, foot and mouth disease in Kawasaki City, Japan. Jpn J Infect Dis. Oct 2005;58(5):330-1.
    • Shimizu H, Utama A, Onnimala N, Li C, Li-Bi Z, Yu-Jie M, et al. Molecular epidemiology of enterovirus 71 infection in the Western Pacific Region. Pediatr Int. Apr 2004;46(2):231-5.
    • Singh S, Poh CL, Chow VT. Complete sequence analyses of enterovirus 71 strains from fatal and non-fatal cases of the hand, foot and mouth disease outbreak in Singapore (2000). Microbiol Immunol. 2002;46(11):801-8.
    • Solomon T. Exotic and emerging viral encephalitides. Curr Opin Neurol. Jun 2003;16(3):411-8.
    • Sutton-Hayes S, Weisse ME, Wilson NW, Ogershok PR. A recurrent presentation of hand, foot, and mouth disease. Clin Pediatr (Phila). May 2006;45(4):373-6.
    • Tseng FC, Huang HC, Chi CY, Lin TL, Liu CC, Jian JW, et al. Epidemiological survey of enterovirus infections occurring in Taiwan between 2000 and 2005: Analysis of sentinel physician surveillance data. J Med Virol. Dec 2007;79(12):1850-60.
    • Wang CY, Li Lu F, Wu MH, Lee CY, Huang LM. Fatal coxsackievirus A16 infection. Pediatr Infect Dis J. Mar 2004;23(3):275-6.
    • Zhu Z, Xu WB, Xu AQ, Wang HY, Zhang Y, Song LZ, et al. Molecular epidemiological analysis of echovirus 19 isolated from an outbreak associated with hand, foot, and mouth disease (HFMD) in Shandong Province of China. Biomed Environ Sci. Aug 2007;20(4):321-8.
    • Tsao KC, Chang PY, Ning HC, Sun CF, Lin TY, Chang LY, et al. Use of molecular assay in diagnosis of hand, foot and mouth disease caused by enterovirus 71 or coxsackievirus A 16. J Virol Methods. Apr 2002;102(1-2):9-14.
    • Tsao LY, Lin CY, Yu YY, Wang BT. Microchip, reverse transcription-polymerase chain reaction and culture methods to detect enterovirus infection in pediatric patients. Pediatr Int. Feb 2006;48(1):5-10.

www.penyakitmenular.com

Provided By: WWW.PENYAKITMENULAR.COM Supported By: GRoW UP CLINIC JAKARTA Yudhasmara Foundation GRoW UP CLINIC I Jl Taman Bendungan Asahan 5 Bendungan Hilir Jakarta Pusat 10210, phone (021) 5703646 – 085101466102 – 085100466103 GRoW UP CLINIC II MENTENG SQUARE Jl Matraman 30 Jakarta Pusat 10430, Phone (021) 2961425208131592-2012 – 08131592-2013 – 08131592-2012 email : judarwanto@gmail.com http://growupclinic.com Facebook: http://www.facebook.com/GrowUpClinic Twitter: @growupclinic Professional Healthcare Provider “GRoW UP CLINIC” Dr Narulita Dewi SpKFR, Physical Medicine & Rehabilitation curriculum vitae HP 085777227790 PIN BB 235CF967 Clinical – Editor in Chief : Dr Widodo Judarwanto, Pediatrician Editor: Audi Yudhasmara email : judarwanto@gmail.com Mobile Phone O8567805533 PIN BBM 76211048 Komunikasi dan Konsultasi online : twitter @widojudarwanto facebook dr Widodo Judarwanto, pediatrician Komunikasi dan Konsultasi Online Alergi Anak : Allergy Clinic Online Komunikasi dan Konsultasi Online Sulit makan dan Gangguan Berat Badan : Picky Eaters Clinic Komunikasi Profesional Pediatric: Indonesia Pediatrician Online. We are guilty of many errors and many faults. But our worst crime is abandoning the children, neglecting the fountain of life.
Information on this web site is provided for informational purposes only and is not a substitute for professional medical advice. You should not use the information on this web site for diagnosing or treating a medical or health condition. You should carefully read all product packaging. If you have or suspect you have a medical problem, promptly contact your professional healthcare provider

Copyright © 2015, WWW.PENYAKITMENULAR.COM, Information Education Network. All rights reserved

Tinggalkan Balasan

Isikan data di bawah atau klik salah satu ikon untuk log in:

Logo WordPress.com

You are commenting using your WordPress.com account. Logout / Ubah )

Gambar Twitter

You are commenting using your Twitter account. Logout / Ubah )

Foto Facebook

You are commenting using your Facebook account. Logout / Ubah )

Foto Google+

You are commenting using your Google+ account. Logout / Ubah )

Connecting to %s